feat: switch to fastp for trimming (#155)

Switching to `fastp` should speed up the adapter trimming and allows for
auto-detection of many adapter sequences.

This pull request also moves from per-project adapter definitions to
per-uni adapter definitions, allowing to combine data from different
sequencing experiments.

<!-- This is an auto-generated comment: release notes by coderabbit.ai
-->
## Summary by CodeRabbit

* **New Features**
* Added support for configuring adapter trimming and extra options for
sequencing reads using `fastp` via new schema fields.

* **Bug Fixes**
  * None.

* **Documentation**
* Updated and expanded documentation to detail configuration of input
files and new `fastp`-based trimming, replacing previous `cutadapt`
instructions.

* **Refactor**
* Switched trimming workflow from `cutadapt` to `fastp`, including
renaming and restructuring rules and outputs.
* Updated file and log output paths to consistently organize results
within sample-specific directories.
* Simplified configuration and schema files by removing all
`cutadapt`-related parameters and sections.
* Improved file path consistency across multiple workflow rules by
nesting outputs within sample-specific subdirectories.
* Changed quality control report categories from "QC" to "quality
control" for clarity.
* Updated GitHub Actions workflows to use newer action versions for
improved CI/CD processes.
<!-- end of auto-generated comment: release notes by coderabbit.ai -->

Author: dlaehnemann

.github/workflows/main.yml

@@ -41,26 +41,26 @@ jobs:
   formatting:
     runs-on: ubuntu-latest
     steps:
-    - uses: actions/checkout@v3
-      with:
-        fetch-depth: 0
-    - name: Formatting
-      uses: github/super-linter@v5
-      env:
-        VALIDATE_ALL_CODEBASE: false
-        DEFAULT_BRANCH: main
-        GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
-        VALIDATE_SNAKEMAKE_SNAKEFMT: true
+      - uses: actions/checkout@v4
+        with:
+          fetch-depth: 0
+      - name: Formatting
+        uses: github/super-linter@v7
+        env:
+          VALIDATE_ALL_CODEBASE: false
+          DEFAULT_BRANCH: main
+          GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }}
+          VALIDATE_SNAKEMAKE_SNAKEFMT: true
   linting:
     runs-on: ubuntu-latest
     steps:
-    - uses: actions/checkout@v3
-    - name: Linting
-      uses: snakemake/snakemake-github-action@v1
-      with:
-        directory: .test
-        snakefile: workflow/Snakefile
-        args: "--lint"
+      - uses: actions/checkout@v4
+      - name: Linting
+        uses: snakemake/snakemake-github-action@v2
+        with:
+          directory: .test
+          snakefile: workflow/Snakefile
+          args: "--lint"
 
   run-rna-workflow:
     runs-on: ubuntu-latest
@@ -69,72 +69,72 @@ jobs:
       - formatting
     steps:
 
-    - name: Free Disk Space (Ubuntu)
-      uses: jlumbroso/[email protected]
-      with:
-        # this might remove tools that are actually needed,
-        # if set to "true" but frees about 6 GB
-        tool-cache: false
-        
-        # all of these default to true, but feel free to set to
-        # "false" if necessary for your workflow
-        android: true
-        dotnet: true
-        haskell: true
-        large-packages: true
-        docker-images: false
-        swap-storage: true
+      - name: Free Disk Space (Ubuntu)
+        uses: jlumbroso/[email protected]
+        with:
+          # this might remove tools that are actually needed,
+          # if set to "true" but frees about 6 GB
+          tool-cache: false
 
-    - name: Checkout repository
-      uses: actions/checkout@v3
-      with:
-        submodules: recursive
+          # all of these default to true, but feel free to set to
+          # "false" if necessary for your workflow
+          android: true
+          dotnet: true
+          haskell: true
+          large-packages: true
+          docker-images: false
+          swap-storage: true
+
+      - name: Checkout repository
+        uses: actions/checkout@v4
+        with:
+          submodules: recursive
+
+      - name: Test workflow
+        uses: snakemake/snakemake-github-action@v2
+        with:
+          directory: .test
+          snakefile: workflow/Snakefile
+          args: "--use-conda --show-failed-logs --cores all --conda-cleanup-pkgs cache --all-temp"
 
-    - name: Test workflow
-      uses: snakemake/snakemake-github-action@v1
-      with:
-        directory: .test
-        snakefile: workflow/Snakefile
-        args: "--use-conda --show-failed-logs --cores all --conda-cleanup-pkgs cache --all-temp"
-  
   run-three-prime-rna-workflow:
     runs-on: ubuntu-latest
     needs:
       - linting
       - formatting
     steps:
-    
-    - name: Free Disk Space (Ubuntu)
-      uses: jlumbroso/[email protected]
-      with:
-        # this might remove tools that are actually needed,
-        # if set to "true" but frees about 6 GB
-        tool-cache: false
-        
-        # all of these default to true, but feel free to set to
-        # "false" if necessary for your workflow
-        android: true
-        dotnet: true
-        haskell: true
-        large-packages: true
-        docker-images: false
-        swap-storage: true
 
-    - name: Checkout repository
-      uses: actions/checkout@v3
+      - name: Free Disk Space (Ubuntu)
+        uses: jlumbroso/[email protected]
+        with:
+          # this might remove tools that are actually needed,
+          # if set to "true" but frees about 6 GB
+          tool-cache: false
+
+          # all of these default to true, but feel free to set to
+          # "false" if necessary for your workflow
+          android: true
+          dotnet: true
+          haskell: true
+          large-packages: true
+          docker-images: false
+          swap-storage: true
+
+      - name: Checkout repository
+        uses: actions/checkout@v4
 
-    - name: Test 3-prime-workflow
-      uses: snakemake/snakemake-github-action@v1
-      with:
-        directory: .test/three_prime
-        snakefile: .test/three_prime/workflow/Snakefile
-        args: "--use-conda --show-failed-logs --cores all --conda-cleanup-pkgs cache --all-temp"
-    # Disable report testing for now since we mark all output files as temporary above.
-    # TODO: add some kind of test mode to report generation which does not really try to include
-    # results.
-    # - name: Test report
-    #   uses: snakemake/snakemake-github-action@v1
-    #   with:
-    #     directory: .test
-    #     snakefile: workflow/Snakefile
-    #     args: "--report report.zip"
+      - name: Test 3-prime-workflow
+        uses: snakemake/snakemake-github-action@v2
+        with:
+          directory: .test/three_prime
+          snakefile: .test/three_prime/workflow/Snakefile
+          args: "--use-conda --show-failed-logs --cores all --conda-cleanup-pkgs cache --all-temp"
+      # Disable report testing for now since we mark all output files as temporary above.
+      # TODO: add some kind of test mode to report generation which does not really try to include
+      # results.
+      # - name: Test report
+      #   uses: snakemake/snakemake-github-action@v1
+      #   with:
+      #     directory: .test
+      #     snakefile: workflow/Snakefile
+      #     args: "--report report.zip"

.test/config/config.yaml

@@ -147,30 +147,3 @@ params:
   #   If you want to decrease this for larger datasets, there paper and
   #   [a reply on GitHub suggest a value of `-b 30`](https://github.com/pachterlab/kallisto/issues/353#issuecomment-1215742328).
   kallisto: "-b 30"
-
-  # these cutadapt parameters need to contain the required flag(s) for
-  # the type of adapter(s) to trim, i.e.:
-  # * https://cutadapt.readthedocs.io/en/stable/guide.html#adapter-types
-  #   * `-a` for 3' adapter in the forward reads
-  #   * `-g` for 5' adapter in the forward reads
-  #   * `-b` for adapters anywhere in the forward reads
-  # also, separate capitalised letter flags are required for adapters in
-  # the reverse reads of paired end sequencing
-  # 
-  # reasoning behind parameters:
-  # * https://cutadapt.readthedocs.io/en/stable/guide.html#trimming-paired-end-reads
-  # * `--minimum-length 33`:
-  #   * kallisto needs non-empty reads in current versions (fixed for future releases:
-  #     https://github.com/pachterlab/kallisto/commit/64fe837ca86f3664496483bcd2787c9376584fed)
-  #   * kallisto default k-mer length is 31 and 33 should give at least 3 k-mers for a read
-  # * `-e 0.005`: the default cutadapt maximum error rate of `0.2` is far too high, for Illumina
-  #   data the error rate is more in the range of `0.005` and setting it accordingly should avoid
-  #   false positive adapter matches
-  # * `--minimum-overlap 7`: the cutadapt default minimum overlap of `5` did trimming on the level
-  #   of expected adapter matches by chance
-  cutadapt-se:
-    adapters: "-a ACGGATCGATCGATCGATCGAT -g GGATCGATCGATCGATCGAT "
-    extra: "--minimum-length 33 -e 0.005 --overlap 7"
-  cutadapt-pe: 
-    adapters: "-a ACGGATCGATCGATCGATCGAT -g GGATCGATCGATCGATCGAT -A ACGGATCGATCGATCGATCGAT -G GGATCGATCGATCGATCGAT"
-    extra: "--minimum-length 33 -e 0.005 --overlap 7"

.test/config/units.tsv

@@ -1,6 +1,6 @@
-sample	unit	fragment_len_mean	fragment_len_sd	fq1	fq2
-A	1			ngs-test-data/reads/a.chr21.1.fq	ngs-test-data/reads/a.chr21.2.fq
-B	1			ngs-test-data/reads/b.chr21.1.fq	ngs-test-data/reads/b.chr21.2.fq
-B	2	300	14	ngs-test-data/reads/b.chr21.1.fq	
-C	1			ngs-test-data/reads/a.chr21.1.fq	ngs-test-data/reads/a.chr21.2.fq
-D	1			ngs-test-data/reads/b.chr21.1.fq	ngs-test-data/reads/b.chr21.2.fq
+sample	unit	fragment_len_mean	fragment_len_sd	fq1	fq2	fastp_adapters	fastp_extra
+A	1			ngs-test-data/reads/a.chr21.1.fq	ngs-test-data/reads/a.chr21.2.fq		
+B	1			ngs-test-data/reads/b.chr21.1.fq	ngs-test-data/reads/b.chr21.2.fq		
+B	2	300	14	ngs-test-data/reads/b.chr21.1.fq			
+C	1			ngs-test-data/reads/a.chr21.1.fq	ngs-test-data/reads/a.chr21.2.fq		
+D	1			ngs-test-data/reads/b.chr21.1.fq	ngs-test-data/reads/b.chr21.2.fq		

.test/three_prime/config/config.yaml

@@ -141,33 +141,3 @@ params:
   #   If you want to decrease this for larger datasets, there paper and
   #   [a reply on GitHub suggest a value of `-b 30`](https://github.com/pachterlab/kallisto/issues/353#issuecomment-1215742328).
   kallisto: "-b 30"
-
-  # these cutadapt parameters need to contain the required flag(s) for
-  # the type of adapter(s) to trim, i.e.:
-  # * https://cutadapt.readthedocs.io/en/stable/guide.html#adapter-types
-  #   * `-a` for 3' adapter in the forward reads
-  #   * `-g` for 5' adapter in the forward reads
-  #   * `-b` for adapters anywhere in the forward reads
-  # also, separate capitalised letter flags are required for adapters in
-  # the reverse reads of paired end sequencing
-  # 
-  # reasoning behind parameters:
-  # * https://cutadapt.readthedocs.io/en/stable/guide.html#trimming-paired-end-reads
-  # * `--minimum-length 33`:
-  #   * kallisto needs non-empty reads in current versions (fixed for future releases:
-  #     https://github.com/pachterlab/kallisto/commit/64fe837ca86f3664496483bcd2787c9376584fed)
-  #   * kallisto default k-mer length is 31 and 33 should give at least 3 k-mers for a read
-  # * `-e 0.005`: the default cutadapt maximum error rate of `0.2` is far too high, for Illumina
-  #   data the error rate is more in the range of `0.005` and setting it accordingly should avoid
-  #   false positive adapter matches
-  # * `--minimum-overlap 7`: the cutadapt default minimum overlap of `5` did trimming on the level
-  #   of expected adapter matches by chance
-  cutadapt-se:
-    # This setup is for Lexogen QuantSeq FWD data, based on (but simplfied):
-    # https://faqs.lexogen.com/faq/what-is-the-adapter-sequence-i-need-to-use-for-t-1
-    # For more details, see the Lexogen 3' QuantSeq section in the `config/README.md` file.
-    adapters: "-a 'r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=7;max_error_rate=0.005'"
-    extra: "--minimum-length 33 --nextseq-trim=20 --poly-a"
-  cutadapt-pe: 
-    adapters: ""
-    extra: ""

.test/three_prime/config/units.tsv

@@ -1,7 +1,7 @@
-sample	unit	fragment_len_mean	fragment_len_sd	fq1	fq2	bam_single	bam_paired
-SRR8309096	u1	430	43	quant_seq_test_data/SRR8309096.fastq.gz	
-SRR8309094	u1	430	43	quant_seq_test_data/SRR8309094.fastq.gz	
-SRR8309095	u1	430	43	quant_seq_test_data/SRR8309095.fastq.gz	
-SRR8309097	u1	430	43	quant_seq_test_data/SRR8309097.fastq.gz	
-SRR8309098	u1	430	43	quant_seq_test_data/SRR8309098.fastq.gz	
-SRR8309099	u1	430	43	quant_seq_test_data/SRR8309099.fastq.gz	
+sample	unit	fragment_len_mean	fragment_len_sd	fq1	fq2	bam_single	bam_paired	fastp_adapters	fastp_extra
+SRR8309096	u1	430	43	quant_seq_test_data/SRR8309096.fastq.gz					
+SRR8309094	u1	430	43	quant_seq_test_data/SRR8309094.fastq.gz					
+SRR8309095	u1	430	43	quant_seq_test_data/SRR8309095.fastq.gz					
+SRR8309097	u1	430	43	quant_seq_test_data/SRR8309097.fastq.gz					
+SRR8309098	u1	430	43	quant_seq_test_data/SRR8309098.fastq.gz					
+SRR8309099	u1	430	43	quant_seq_test_data/SRR8309099.fastq.gz