It looks like the ingroup sequences are not conserved as I would expect and the phrase in the README 'we want the diagnostic nucleotide to be conserved in our "ingroup" and different in our "outgroup".'
The README also has this output result:
> Alignment 0
CGACAAGATACTCTCGCAGCTTGGTCAG : ingroup0
.........................A.. : ingroup1
.........................G.. : outgroup0;outgroup1;outgroup2
> Alignment 1
TGACGCAGATCATCCCGCGCTTACTGAC : ingroup0
.........................T.. : ingroup1
.........................C.. : outgroup0;outgroup1;outgroup2
=> Found 2 alignments in 0.60 seconds
This does not seem right to me, but maybe I am missing something.
@toopz, Is this result intended or is the "outgroup" the group that the diagnostic being designed for?
It looks like the ingroup sequences are not conserved as I would expect and the phrase in the README 'we want the diagnostic nucleotide to be conserved in our "ingroup" and different in our "outgroup".'
The README also has this output result:
This does not seem right to me, but maybe I am missing something.
@toopz, Is this result intended or is the "outgroup" the group that the diagnostic being designed for?