-
Notifications
You must be signed in to change notification settings - Fork 6
Home
FluentDNA is a multi-platform command-line tool for generating visualizations of DNA data.
After you have the software installed (see: installation instructions), the command line is used to generate visualizations that are accessible through a localhost web browser or a local image viewer. First, launch the FluentDNA server using fluentdna.py --runserver
This will make all your results available at http://127.0.0.1:8000
Generating a basic visualization of a FASTA file downloaded from NCBI or another source is accomplished with the following commands:
Command: fluentdna.py --fasta="example_data/hg38_chr19_sample.fa" --outname="Test Simple"
This generates an image pyramid with the standard legend (insert image of legend) and nucleotide number display.
Input Data Example:
- FA File: https://github.com/josiahseaman/FluentDNA/blob/python-master/DDV/example_data/hg38_chr19_sample.fa
Result: Hg38 chr19 sample
It is also possible to generate an image file only that can be accessed with an image viewer using --no_webpage
.
Command: fluentdna.py --fasta="example_data/hg38_chr19_sample.fa" --outname="Test Simple" --no_webpage
Multi-part FASTA format includes multiple sequences in the same file. A sequence record in a FASTA format consists of a single-line description (sequence name), followed by line(s) of sequence data. The first character of the description line is a greater-than (">") symbol. Multi-part format Example:
>seq0
AATGCCA
>seq1
GCCCTAT
The following command generates a multi-part FASTA file visualization:
Input Data Example:
Command: fluentdna.py --fasta="example_data/Human selenoproteins.fa"
Result: Human Selenoproteins
This generates a multi-scale image of the multi-part FASTA file. Note that if you don't specify --outname=
it will default to the name of the FASTA file.
Using this simple command, FluentDNA can visualize an entire draft genome at once.
Result: Ash Tree Genome (Fraxinus excelsior)
Additional options - see also:
--outname
--sort_contigs
--no_titles
--natural_colors
--base_width
By specifying --ref_annotation=
you can include a gene annotation to be rendered alongside your sequence. This is currently setup to show gene introns and exons. But the features rendered and colors used can be changed in DDV/Annotations.py
Command: fluentdna.py --fasta="example_data/gnetum_sample.fa" --ref_annotation="example_data/Gnetum_sample_genes.gff"
Input Data Example:
- GFF File: https://github.com/josiahseaman/FluentDNA/blob/python-master/DDV/example_data/Gnetum_sample_genes.gff
- FA file: https://github.com/josiahseaman/FluentDNA/blob/python-master/DDV/example_data/gnetum_sample.fa
Result: Gnetum montanum Annotation
You can download the full Gnetum montanum files from Data Dryad.
To visualize a multiple sequence alignment you need to use the --layout=alignment
option to tell FluentDNA to treat each entry in a multipart fasta file as being one row of an alignment. To show many MSAs at once, just point --fasta=
to a folder instead of a file.
Input Data Example:
- Folder with FA files: https://github.com/josiahseaman/FluentDNA/tree/python-master/DDV/example_data/alignments
Important Note! Make sure there are no other files in your folder besides sequence files. If FluentDNA decides on an unreasonably long "max width" it is because it picked up a non-sequence file in the folder.
Each fasta file represents one aligned protein family. The input fasta file should already be aligned with another program. Each protein is represented by one entry in the fasta file with -
inserted for gap characters like this:
>GeneA_in_species1
ACTCA--ACGATC------GGGT
>GeneA_in_species2
ACTCAAAACGATCTCTCTAGGGT
Command: fluentdna.py --layout=alignment --fasta="example_data\alignments" --outname="Example 7 Gene Families from Fraxinus"
This generates a multi-scale image of the multiple alignment. The multiple alignment results are sorted by gene name. For a smoother layout use --sort_contigs
which will sort them by row count (copy number).
Result: Example 7 Gene Families from Fraxinus
This layout allows users to check thousands of MSAs. Here we used FluentDNA to quality check the merging software for 2,961 putative gene families: Fraxinus Homologous Gene Groups
This generates an alignment visualization of two genomes (A and B). Since this is a whole genome alignment the files are very large and not included in the FluentDNA installation. Download each of these files and unzip them into a local folder called data/
.
- Human Genome FA File (hg38.fa)
- Alignment LiftOver Chain File (hg38ToPanTro5.over.chain)
- Chimpanzee Genome FA file (panTro5.fa)
Command: fluentdna.py --fasta=data/hg38.fa --chainfile=data/hg38ToPanTro5.over.chain --extrafastas data/panTro5.fa --chromosomes chr19 --outname="Human vs Chimpanzee"
This generates a multi-scale image of the alignment. There are 4 columns in this visualization:
- Column 1. Genome A (gapped entire DNA of genome A)
- Column 2. Genome A (unique DNA of A)
- Column 3. Genome B (unique DNA of B)
- Column 4. Genome B (gapped entire DNA of genome B)
Result: Human vs Chimpanzee_chr19 (natural colors)
Figure 1 in the paper can be seen at Nucleotide Position 548,505 which corresponds to HG38 chr19:458,731. The difference in coordinates is due to the gaps inserted for sake of alignment.
Note: Whole genome alignment visualizations can be processed in batches, one visualization per chromosome. Simply specify each of the reference chromosomes that you would like to generate. --outname
will be used as a prefix for the name of the folder and the visualization. For example, the above command generates a folder called "Human vs Chimpanzee_chr19".